June 2025 Living Environment Regents — Answer Key & Worked Solutions

Every question from the June 2025 Living Environment Regents exam, with the correct answer and a full step-by-step solution. Check your work, learn the method, then convert your raw score.

Practice Living Environment free Score calculator

These are real questions from the June 2025 Living Environment New York State Regents examination, published by NYSED. Worked solutions are written by RegentsLab.

Question 1 · 2 pts

Which of these components are found in all living organisms?

(A) estrogen and testosterone
(B) insulin and water
(C) chlorophyll and hemoglobin
(D) cytoplasm and ATP ✓

Worked solution

$\text{All cells contain cytoplasm as their internal matrix}$

$\text{All cells use ATP as their energy currency}$

$\text{Hormones, insulin, chlorophyll, and hemoglobin are only found in specific organisms/cell types}$

Answer: cytoplasm and ATP

All cells, in every organism, contain cytoplasm and use ATP for energy; the other pairs are restricted to particular organisms or cell types.

Question 2 · 2 pts

Two types of molecules directly involved in cellular communication are

(A) hormones and nerve cell chemicals ✓
(B) fats and carbohydrates
(C) ATP and carbon dioxide
(D) glucose and oxygen

Worked solution

$\text{Hormones are chemical messengers released into the bloodstream}$

$\text{Neurotransmitters (nerve cell chemicals) transmit signals between neurons and other cells}$

$\text{Fats, carbohydrates, ATP, CO}_2\text{, glucose, and O}_2\text{ are metabolic, not signaling, molecules}$

Answer: hormones and nerve cell chemicals

Hormones and neurotransmitters are signaling molecules cells use to communicate and coordinate body functions, unlike purely metabolic molecules.

Question 3 · 2 pts

When mountain lions consume large prey, they often leave large pieces of their prey behind. The carcass that is left becomes a food source for other organisms. A scientist reported a count of 24,000 beetles in an area where mountain lions had left partially eaten carcasses. Wolves, bears, and other animals also take advantage of the remains of the prey. The role of the mountain lion in this ecosystem is an example of the concept that

(A) ecosystems require a large number of predators to increase the number of prey
(B) populations are linked with many others in a stable ecosystem ✓
(C) large animals waste food, resulting in harm to other organisms in the ecosystem
(D) predators should consume small prey to protect the diversity of the ecosystem

Worked solution

$\text{Leftover carcasses from mountain lion kills feed beetles, wolves, bears, and other scavengers}$

$\text{This flow of energy/resources between species shows interdependence}$

$\text{A stable ecosystem consists of many interconnected populations, not isolated ones}$

Answer: populations are linked with many others in a stable ecosystem

The mountain lion's leftover carcasses support beetles, wolves, bears, and other scavengers, showing that populations across a community are interconnected and dependent on one another.

Question 4 · 2 pts

Mutations are an important part of evolution. One reason for this is that mutations

(A) that occur in body cells are passed to offspring
(B) are random events that always increase the ability of members to reproduce
(C) occur only in sexually reproducing organisms
(D) may result in gene variations that provide a survival advantage ✓

Worked solution

$\text{Mutations are random, heritable changes in DNA (in gametes) that create variation}$

$\text{Some variations may increase an organism's fitness/survival}$

$\text{Body-cell mutations are not inherited; mutations do not always help; they occur in asexual organisms too}$

Answer: may result in gene variations that provide a survival advantage

Mutations create new genetic variations within a population, some of which may improve an organism's ability to survive and reproduce, driving evolution through natural selection.

Question 5 · 2 pts

Ladybugs that eat plant pests are currently raised and sold commercially to gardeners. It was assumed that all of the imported ladybugs would remain within the garden area and consume only the harmful insect pests. It is now known that the ladybugs can travel widely, with one study showing that within a few days, 99% had left the area where they were originally released. One environmental concern regarding the use of ladybugs to control insect pests could be that

(A) ladybugs are an endangered species and must be collected in the wild
(B) ladybugs are a safer alternative than the use of chemical pesticides
(C) the migration of introduced ladybugs may affect food webs in other areas ✓
(D) the action of ladybugs may reduce insect pest populations

Worked solution

$\text{99\% of released ladybugs leave the intended garden area within days}$

$\text{Ladybugs that spread elsewhere can prey on or compete with native species there}$

$\text{This alters the food web structure of the areas they migrate into}$

Answer: the migration of introduced ladybugs may affect food webs in other areas

Since released ladybugs quickly disperse beyond the target garden, they can become invasive predators or competitors elsewhere, altering food webs in areas where they were not intended to be introduced.

Question 6 · 2 pts

The best-adapted individuals in a population are most likely to be successful in passing on their traits to the next generation because

(A) they were able to survive the conditions of their environment when others could not ✓
(B) their offspring will be better able to cope with any environmental changes that may occur
(C) their genes are the strongest, which will help them attract suitable mates
(D) they are less attractive and are less likely to find suitable mates

Worked solution

$\text{Best-adapted individuals survive environmental pressures that eliminate less-adapted individuals}$

$\text{Surviving to reproductive age allows them to pass their traits to offspring}$

$\text{Options 2-4 rely on unsupported claims (future changes, "strongest genes", attractiveness)}$

Answer: they were able to survive the conditions of their environment when others could not

Natural selection favors individuals whose traits allow them to survive long enough to reproduce; survival is the mechanism, not attractiveness of genes.

Question 7 · 2 pts

Some structures found in living organisms are shown below: a protein molecule, a DNA molecule, and a cell. Which statement best describes the relationship among the three structures?

(A) DNA is produced by large protein molecules that diffuse into the cell.
(B) Protein is composed of DNA that is produced in the cell.
(C) DNA controls the production of protein in the cell. ✓
(D) A cell is composed entirely of DNA and protein.

Worked solution

$\text{DNA encodes genetic instructions for making proteins}$

$\text{These instructions are carried out inside the cell (transcription/translation)}$

$\text{Other choices misstate the relationship among the structures}$

Answer: DNA controls the production of protein in the cell.

DNA contains the genetic code that directs protein synthesis, which occurs within cells; this describes the actual functional relationship among the three structures.

Question 8 · 2 pts

Scientists found that over a period of 300 years, a pond slowly transformed into a meadow and then a forest. During that time, communities of organisms were replaced by different communities. The best explanation for why new communities were able to replace the older communities is that

(A) the species in the old communities died of disease
(B) the environment gradually changed, making the area less favorable for the old communities ✓
(C) there was a lack of predators for the new communities of organisms
(D) the original species suddenly became extinct

Worked solution

$\text{The pond-to-meadow-to-forest transition is ecological succession}$

$\text{Gradual environmental changes make conditions unsuitable for earlier communities}$

$\text{New species better suited to the changed conditions replace the old ones}$

Answer: the environment gradually changed, making the area less favorable for the old communities

This describes ecological succession, where gradual environmental changes make conditions unsuitable for earlier communities and favorable for new ones.

Question 9 · 2 pts

Many species of warblers, including the Blackburnian warbler shown below, migrate from Central and South America to New York State, where they breed each summer. Warblers primarily prey on insects and nest in hemlock trees. An invasive insect, the wooly adelgid, is killing hemlock trees across the entire state. If this continues, fewer warblers will be able to find suitable nesting sites. One consequence of this may be that

(A) there will be more food for birds that prey on warblers and other small birds
(B) fewer acorns will grow on the oak trees that also grow in the forest
(C) insect pest populations will increase because fewer warblers are present ✓
(D) more warbler eggs will be hatched in Central and South America to increase the population

Worked solution

$\text{Hemlock loss removes nesting habitat, reducing warbler numbers in NY}$

$\text{Warblers primarily control insect populations by preying on them}$

$\text{Fewer warblers means less predation pressure, so insect (pest) populations rise}$

Answer: insect pest populations will increase because fewer warblers are present

Since warblers are insect predators, a decline in warbler nesting due to hemlock loss reduces predation pressure on insects, allowing insect populations, including pests, to rise.

Question 10 · 2 pts

Seagrass populations decrease significantly in size when sea turtles overgraze the area in which the grasses grow. When predators such as sharks have a constant presence in the same area, the turtles leave and the seagrass population increases. This is an example of how organisms

(A) influence other species in a community ✓
(B) balance their basic nutritional needs
(C) maintain their own internal stability
(D) depend on physical conditions for survival

Worked solution

$\text{Sharks affect turtle presence/behavior through predation risk}$

$\text{Turtle grazing behavior affects seagrass population size}$

$\text{This chain shows organisms influencing each other's abundance/behavior}$

Answer: influence other species in a community

The presence of sharks influences turtle behavior, which in turn influences seagrass abundance, illustrating how organisms in a community affect one another through trophic interactions.

Question 11 · 2 pts

Strawberry plants grow runners off of the main parent plant, as shown in the photo below. New strawberry plants that are genetically identical to the parent plant develop along the runners. This phenomenon can be best explained by the fact that these strawberry plants are produced by

(A) asexual reproduction, and the new plants develop by mitosis and differentiation ✓
(B) sexual reproduction, and the new plants develop by meiosis and fertilization
(C) asexual reproduction, and the new plants develop by meiosis and fertilization
(D) sexual reproduction, and the new plants develop by mitosis and differentiation

Worked solution

$\text{Genetically identical offspring result from asexual reproduction (no gamete fusion)}$

$\text{Mitosis produces genetically identical cells that build the new plant}$

$\text{Differentiation allows cells to develop into specialized structures}$

Answer: asexual reproduction, and the new plants develop by mitosis and differentiation

Runners produce genetically identical clones through asexual reproduction, with new plant structures forming via mitotic division and subsequent differentiation.

Question 12 · 2 pts

During a class field trip, a student measured and recorded some abiotic factors present in a pond. Which data did the student most likely include in their record of abiotic factors?

(A) the number of possible food chains and food webs
(B) the diversity of decomposers and their total mass
(C) the temperature and pH of the water ✓
(D) the size and number of fish species

Worked solution

$\text{Abiotic factors are nonliving parts of an ecosystem}$

$\text{Food chains, decomposer diversity, and fish counts describe living organisms (biotic)}$

$\text{Temperature and pH are nonliving, physical/chemical measurements}$

Answer: the temperature and pH of the water

Abiotic factors are nonliving components of an environment; temperature and pH are physical/chemical measurements, unlike the other choices which describe living organisms.

Question 13 · 2 pts

Mammals, including humans, dolphins, and cows, produce milk for their young. Surprisingly, researchers have discovered that certain spiders also produce a milk-like fluid for their young. The spider leaves droplets of her "milk" around the nest for the babies after they hatch from their eggs. After one week, the babies will feed on the "milk" directly from her body for at least 20 days. Which statement best describes this recent discovery?

(A) It proves that all female animals produce the same hormones to make milk.
(B) The discovery will allow for the re-classification of spiders as mammals.
(C) It is an example of parental care for the survival of their offspring. ✓
(D) The discovery confirms that spiders provide mammal milk to their offspring.

Worked solution

$\text{The spider actively provisions her offspring with a nutrient fluid after hatching}$

$\text{This behavior increases the survival chances of the young}$

$\text{Other choices make unsupported overgeneralizations not justified by the passage}$

Answer: It is an example of parental care for the survival of their offspring.

The spider's milk-like secretion nourishes and protects her young after hatching, which is a form of parental care that increases offspring survival.

Question 14 · 2 pts

As part of the "Charge NY" energy plan, New York drivers are being encouraged to purchase electrically powered cars. Many believe that this will help the environment by

(A) reducing the number of cars on the road, since drivers will only be able to go short distances before having to recharge the battery
(B) reducing local air pollution by lowering levels of carbon dioxide and other pollutants ✓
(C) decreasing the number of car sales, since electric cars are more expensive than gasoline-powered cars
(D) decreasing the consumption of fossil fuels, since only renewable energy sources can be used to generate electricity

Worked solution

$\text{Electric cars do not burn gasoline and emit no tailpipe pollutants}$

$\text{This directly lowers local levels of carbon dioxide and other air pollutants}$

$\text{Other choices contain factually incorrect claims about car numbers, sales, or electricity sources}$

Answer: reducing local air pollution by lowering levels of carbon dioxide and other pollutants

Electric vehicles produce no tailpipe emissions, so widespread adoption reduces local air pollution, including carbon dioxide and other pollutant output compared to gasoline vehicles.

Question 15 · 2 pts

The New Mexico whiptail is a female-only species of lizard that exhibits an unusual form of asexual reproduction. Researchers discovered that these lizards produce eggs that have a full set of chromosomes and have the genetic diversity of sexually reproducing lizards. Which statement best describes the offspring of these lizards?

(A) The offspring are a result of uniting a male and female gamete.
(B) The offspring develop from eggs with twice the genetic information of the female lizard.
(C) The offspring have cells that contain DNA found only in the female lizard. ✓
(D) The offspring are genetically identical to each other and the female lizard.

Worked solution

$\text{Only females exist in this species, so no male gamete contributes DNA}$

$\text{The eggs already contain a full chromosome set, formed without fertilization}$

$\text{All offspring DNA therefore originates only from the mother}$

Answer: The offspring have cells that contain DNA found only in the female lizard.

Since the species reproduces asexually with no male involved, all genetic material in the offspring originates solely from the female parent.

Question 16 · 2 pts

In humans, the placenta is important to the developing embryo. Which essential life functions are carried out by the placenta?

(A) nutrition, excretion, and reproduction
(B) respiration, nutrition, and excretion ✓
(C) movement, reproduction, and nutrition
(D) coordination, immunity, and movement

Worked solution

$\text{The placenta delivers oxygen and nutrients from mother to embryo (respiration, nutrition)}$

$\text{It removes metabolic wastes from the embryo's blood (excretion)}$

$\text{Reproduction, movement, coordination, and immunity are not placental functions}$

Answer: respiration, nutrition, and excretion

The placenta transfers nutrients and oxygen from mother to embryo (nutrition, respiration) and removes wastes (excretion), performing these essential life functions on the embryo's behalf.

Question 17 · 2 pts

Injecting individuals with a vaccine composed of killed bacteria protects them from a disease because the proteins from the killed bacteria

(A) serve as food for invading pathogens, which prevents them from feeding on human proteins
(B) bind with cell nuclei, preventing live pathogenic bacteria from binding with the nuclei later
(C) cause a mild case of the disease, preventing the immune system from responding to future infections
(D) stimulate the production of antibodies that can be produced in response to an infection ✓

Worked solution

$\text{Killed bacteria still carry surface proteins (antigens) recognized by the immune system}$

$\text{The immune system produces specific antibodies against these antigens}$

$\text{Memory of this response allows rapid antibody production upon later exposure}$

Answer: stimulate the production of antibodies that can be produced in response to an infection

Vaccines introduce antigens from killed pathogens that trigger the immune system to produce antibodies and memory cells, enabling a faster response upon future exposure to the live pathogen.

Question 18 · 2 pts

Which statement about amino acids and simple sugars is correct?

(A) Amino acids are used to build inorganic molecules, and simple sugars are used to build organic molecules.
(B) Starches are digested into amino acids, and proteins are digested into simple sugars.
(C) Amino acids and simple sugars are used as building blocks in the synthesis of organic compounds. ✓
(D) Amino acids can enter cells, and simple sugars cannot enter cells.

Worked solution

$\text{Amino acids link to form proteins, which are organic compounds}$

$\text{Simple sugars link to form complex carbohydrates, also organic compounds}$

$\text{Other choices misstate digestion products and molecule types}$

Answer: Amino acids and simple sugars are used as building blocks in the synthesis of organic compounds.

Amino acids are monomers of proteins and simple sugars are monomers of carbohydrates; both serve as building blocks that cells assemble into larger organic molecules.

Question 19 · 2 pts

Protein chains may break. This can cause a problem for living cells because

(A) if the proteins break, the cell will contain more proteins than it needs
(B) if the chains break, the amino acids will poison the cell, destroying organelles
(C) the broken proteins will not interact with other molecules correctly ✓
(D) the broken chains will attack the ribosomes of the cell and shut them down

Worked solution

$\text{Protein function depends on a precise folded shape from its amino acid chain}$

$\text{Breaking the chain destroys this shape}$

$\text{The protein can no longer interact correctly with its target molecules}$

Answer: the broken proteins will not interact with other molecules correctly

A protein's specific three-dimensional shape determines its function; if the chain breaks, its shape and ability to properly bind or interact with other molecules is lost.

Question 20 · 2 pts

Enzymes are essential to maintaining homeostasis and helping to regulate human metabolism. They are also examples of molecules that are

(A) composed of complex carbohydrates
(B) not specific to any life function
(C) synthesized by the cell membrane
(D) influenced by pH ✓

Worked solution

$\text{Enzymes are proteins made of amino acids, not carbohydrates}$

$\text{Enzymes are highly specific to particular reactions/life functions}$

$\text{Enzyme activity changes with pH because pH affects the enzyme's shape and active site}$

Answer: influenced by pH

Enzymes are proteins whose shape, and therefore activity, is sensitive to environmental conditions such as pH, which can denature them or alter their efficiency.

Question 21 · 2 pts

The process by which DNA molecules separate and add new molecular bases to form another DNA molecule is called

(A) protein synthesis
(B) cell membrane synthesis
(C) replication ✓
(D) mitosis

Worked solution

$\text{The DNA double helix separates into two single strands}$

$\text{Each strand acts as a template on which complementary bases are added}$

$\text{This produces two identical DNA molecules, a process called replication}$

Answer: replication

DNA replication is the process where the double helix unwinds and separates, and each strand serves as a template for adding complementary bases to form a new, identical DNA molecule.

Question 22 · 2 pts

Which row in the chart below correctly describes activities that occur in each of the two organelles shown?

(A) Row (1): chloroplast uses glucose as it functions; mitochondrion makes glucose as it functions
(B) Row (2): chloroplast makes glucose as it functions; mitochondrion uses glucose as it functions ✓
(C) Row (3): chloroplast uses oxygen as it functions; mitochondrion makes oxygen as it functions
(D) Row (4): chloroplast uses oxygen as an energy source; mitochondrion uses carbon dioxide as an energy source

Worked solution

$\text{Chloroplasts perform photosynthesis, synthesizing (making) glucose using light energy}$

$\text{Mitochondria perform cellular respiration, breaking down (using) glucose to produce ATP}$

$\text{Row 2 correctly pairs "makes glucose" with chloroplast and "uses glucose" with mitochondrion}$

Answer: Row (2): chloroplast makes glucose as it functions; mitochondrion uses glucose as it functions

Chloroplasts carry out photosynthesis, producing glucose, while mitochondria carry out cellular respiration, consuming glucose to release energy; row 2 correctly pairs these functions.

Question 23 · 2 pts

The amount of fossil fuels consumed from 1800 until 2017 is shown in the graph below. Global fossil fuel consumption: Global primary energy consumption by fossil fuel source, measured in terawatt-hours (TWh). The graph shows a stacked area chart with three fuel sources (Coal, Crude oil, Natural gas) from 1800 to 2017, with total consumption rising slowly until about 1950 and then increasing sharply, reaching over 120,000 TWh by 2017. The increased demand for and use of fossil fuels is a direct result of an

(A) increased focus on renewable energy sources
(B) increased concern for environmental stability
(C) increase in atmospheric changes
(D) increase in industrialization ✓

Worked solution

$The graph shows fossil fuel use rising sharply starting around 1950, coinciding with rapid global industrial growth.$

$Industrialization requires large amounts of energy for manufacturing, transportation, and electricity, driving fossil fuel demand upward.$

Answer: increase in industrialization

The sharp rise in fossil fuel consumption tracks the pace of industrial development, not environmental concern or renewable energy adoption.

Question 24 · 2 pts

Some prescription drugs come with a warning that these drugs should be avoided during the early stages of pregnancy. The reason that pregnant women should avoid certain medications early in their pregnancy is because the drug may

(A) affect the development of organs in the fetus ✓
(B) interfere with meiosis
(C) allow differentiation to occur
(D) interfere with fertilization

Worked solution

$Early pregnancy is when cells are rapidly dividing and differentiating into tissues and organs.$

$Drugs present during this critical period can disrupt normal organ formation, causing birth defects.$

Answer: affect the development of organs in the fetus

Since fertilization has already occurred by the time pregnancy is diagnosed, the concern is disruption of organ development, not meiosis or fertilization.

Question 25 · 2 pts

Lions in East Africa are night hunters. They are most successful during the darker phases of the moon, when they are less visible. Prey animals, such as the wildebeest shown below, are also influenced by the moon cycles and amount of darkness. During the dark phases of the moon, they are less active. This behavior shows that

(A) predator behaviors are controlled by the carrying capacity of the environment
(B) environmental factors can influence the behavior of predators and their prey ✓
(C) producers directly regulate the number of predators in a community
(D) consumers influence the physical factors in the predator's ecosystem

Worked solution

$Moonlight, an abiotic/physical environmental factor, changes lion hunting success and wildebeest activity levels.$

$Because both predator and prey behavior change with moon phase, this is an environmental influence on behavior.$

Answer: environmental factors can influence the behavior of predators and their prey

The scenario describes an abiotic factor (moonlight) altering the behavior of both a predator and its prey, not carrying capacity or producer regulation.

Question 26 · 2 pts

The removal of three consecutive base-subunits from a gene would most directly affect the

(A) membrane of a cell
(B) structure of a protein ✓
(C) pH of the cytoplasm
(D) size of a cell nucleus

Worked solution

$A gene's base sequence is read in codons of three bases to specify amino acids.$

$Removing three consecutive bases deletes exactly one codon, removing one amino acid from the resulting protein and changing its structure.$

Answer: structure of a protein

Since three bases correspond to one codon/amino acid, deleting them directly alters the protein's amino acid sequence and structure, not the membrane, pH, or nucleus.

Question 27 · 2 pts

Some medications have been found to damage mitochondria. This can upset metabolism because mitochondria

(A) synthesize energy to make organic compounds
(B) produce carbon dioxide, which is used for cellular respiration
(C) release oxygen, which is necessary for photosynthesis
(D) produce ATP molecules used for cellular processes ✓

Worked solution

$Mitochondria are the site of aerobic cellular respiration.$

$They convert chemical energy from food into ATP, which powers cellular processes throughout the cell.$

Answer: produce ATP molecules used for cellular processes

Mitochondria's primary function is producing ATP, so damage to them disrupts the cell's energy supply and metabolism.

Question 28 · 2 pts

The Labrador retriever is a breed of dog that is characterized by a solid yellow, brown, or black coat and a friendly personality. In order to increase the chances of Labrador retriever puppies having these traits, breeders should

(A) insert the genes for these traits into the cells of the puppies
(B) increase genetic variation by mating dogs with different traits
(C) breed only dogs with the desired traits to produce puppies ✓
(D) use asexual reproduction to breed dogs with a variety of traits

Worked solution

$Selective breeding involves choosing parents with the desired traits so those traits are more likely to be passed to offspring.$

$Mating dogs that already display solid coat color and friendly personality increases the probability puppies inherit those traits.$

Answer: breed only dogs with the desired traits to produce puppies

Selective breeding of individuals already expressing the desired traits, not gene insertion or increased variation, increases the likelihood of offspring with those traits.

Question 29 · 2 pts

An example of a harmful immune response occurs when immune cells cause the breakdown of

(A) cancerous tissue
(B) bacteria cells
(C) pathogenic viruses
(D) transplanted organs ✓

Worked solution

$The immune system normally destroys harmful invaders like bacteria, viruses, and cancerous cells, which is beneficial.$

$When the immune system attacks a transplanted organ as foreign tissue, this is a harmful response called organ rejection.$

Answer: transplanted organs

Attacking bacteria, viruses, or cancer cells is beneficial, but attacking a transplanted organ is a harmful immune response known as rejection.

Question 30 · 2 pts

Individuals who use tanning beds have an increased risk of getting skin cancer. Their skin cancer may

(A) be passed to their offspring because it is a gene mutation
(B) spread in the individual but will not be directly passed to their offspring ✓
(C) result in the offspring having immunity to skin cancer
(D) help their offspring better adapt to skin cancer in sunnier climates

Worked solution

$Skin cancer arises from mutations in body (somatic) cells, not in sex cells (sperm or egg).$

$Only mutations in sex cells are passed to offspring, so the cancer can spread within the individual but is not inherited.$

Answer: spread in the individual but will not be directly passed to their offspring

Because tanning-bed-induced mutations occur in somatic skin cells rather than gametes, the cancer is not heritable, though it can spread within the affected individual.

Question 31 · 2 pts

Base your answer on the information and nitrogen-cycling model. Material cycles are necessary to recycle substances needed and used by organisms in their habitat. The atmosphere is composed of about 80% nitrogen gas (N2) that cannot be used by most organisms in that form. It is through the action of many different types of bacteria that the nitrogen gas can be made available to other organisms. The diagram below represents a model of the nitrogen cycle, showing Atmospheric Nitrogen (N2) connected via nitrogen-fixing bacteria in legume root nodules and nitrogen-fixing soil bacteria to Ammonium (NH4+), which nitrifying bacteria convert to Nitrite (NO2-) then Nitrate (NO3-); nitrate is assimilated by plants, decomposed by aerobic/anaerobic bacteria back to ammonium (ammonification), and denitrifying bacteria convert nitrate back to atmospheric nitrogen (denitrification). Based on the model, which bacteria are able to convert atmospheric nitrogen gas to nitrogen compounds in the soil?

(A) aerobic and anaerobic bacteria
(B) nitrifying bacteria
(C) nitrogen-fixing bacteria ✓
(D) denitrifying bacteria

Worked solution

$The diagram shows arrows from Atmospheric Nitrogen (N2) to Ammonium (NH4+) passing through nitrogen-fixing bacteria (both in legume root nodules and in soil).$

$This process, called nitrogen fixation, converts unusable N2 gas into a usable nitrogen compound (ammonium) in the soil.$

Answer: nitrogen-fixing bacteria

Nitrogen-fixing bacteria are the organisms in the model that convert atmospheric N2 into ammonium compounds usable in soil.

Question 32 · 2 pts

Based on the nitrogen-cycling model described above (see question 31 for full diagram description), which two organisms carry out opposite processes?

(A) nitrifying bacteria and nitrogen-fixing bacteria in the soil
(B) nitrogen-fixing bacteria in the soil and nitrogen-fixing bacteria in legumes
(C) aerobic bacteria and anaerobic bacteria
(D) denitrifying bacteria and nitrogen-fixing bacteria in the soil ✓

Worked solution

$Nitrogen-fixing bacteria convert atmospheric N2 gas into ammonium in the soil.$

$Denitrifying bacteria convert nitrate back into atmospheric N2 gas, the reverse direction, making these two processes opposites.$

Answer: denitrifying bacteria and nitrogen-fixing bacteria in the soil

Nitrogen fixation moves nitrogen from the atmosphere into the soil, while denitrification moves it from the soil back into the atmosphere, the reverse process.

Question 33 · 2 pts

Plants can use nitrates from the soil to make amino acids such as alanine (C3H7NO2). Two other substances plants take in from their environment that would provide all of the components to make many alanine molecules are

(A) carbon dioxide (CO2) and water (H2O) ✓
(B) carbon dioxide (CO2) and sunlight
(C) water (H2O) and oxygen (O2)
(D) glucose (C6H12O6) and oxygen (O2)

Worked solution

$Alanine (C3H7NO2) contains carbon, hydrogen, nitrogen, and oxygen atoms.$

$Nitrogen comes from nitrates taken up from soil; carbon dioxide and water supply the remaining carbon, hydrogen, and oxygen atoms.$

$Sunlight is energy, not matter, and oxygen gas/glucose are not the raw materials plants absorb for this purpose, so CO2 and H2O are the correct raw material inputs.$

Answer: carbon dioxide (CO2) and water (H2O)

Combined with nitrate (the nitrogen source), CO2 and H2O supply the carbon, hydrogen, and oxygen atoms needed to build alanine molecules.

Question 34 · 2 pts

If all of the aerobic and anaerobic bacteria indicated as decomposers in the model were lost from this ecosystem, the most likely effect would be

(A) a decrease in the carrying capacity for nitrogen-fixing bacteria
(B) an increase in the number of nitrifying bacteria
(C) a decrease in the carrying capacity for plants ✓
(D) an increase in activity of the nitrifying bacteria

Worked solution

$Decomposers break down dead organic matter into ammonium (ammonification), which nitrifying bacteria then convert into forms plants can use.$

$Without decomposers, less ammonium and eventually less nitrate would be available, reducing the amount of usable nitrogen for plants.$

$Less available nitrogen means the ecosystem could support fewer plants, decreasing plant carrying capacity.$

Answer: a decrease in the carrying capacity for plants

Loss of decomposers cuts off a key source of recycled nitrogen (ammonification), reducing nitrogen availability and thus the number of plants the ecosystem can support.

Question 35 · 2 pts

Male Pacific field crickets make a loud song that travels a long distance to attract females. They use their wings to create the sound. On the island of Kauai, the loud calls not only attract mates, but also a specific fly species. The fly deposits larvae on the cricket. As the fly larvae mature, they eat the cricket from the inside out. One summer, observers on Kauai noticed that the crickets were unusually quiet. They also noticed that the wings of these quiet crickets were shaped differently. The scientists hypothesized that the wing mutation helped crickets escape the fly. They collected the following data while testing their hypothesis: Male Pacific Field Crickets data table: Fly Larvae Present: Without Wing Mutation = 30, With Wing Mutation = 1 Fly Larvae Not Present: Without Wing Mutation = 70, With Wing Mutation = 121 Percent With Larvae: Without Wing Mutation = 30%, With Wing Mutation = 0.8% Which statement most accurately describes the relationship between the data and the original hypothesis?

(A) The data support the hypothesis because crickets with the mutation had fewer fly larvae. ✓
(B) The data support the hypothesis because crickets without the mutation had a greater percentage of survivors.
(C) The data do not support the hypothesis because crickets with the mutation had more fly larvae.
(D) The data do not support the hypothesis because crickets with the mutation had a smaller percentage of survivors.

Worked solution

$Only 0.8% of mutant-winged crickets had fly larvae compared to 30% of crickets without the mutation.$

$This large drop in infestation rate matches the hypothesis that the wing mutation, which silences the cricket's call, helps crickets escape the parasitic fly.$

Answer: The data support the hypothesis because crickets with the mutation had fewer fly larvae.

The much lower percentage of larvae infestation in mutant crickets directly supports the hypothesis that the silent wing mutation helps them avoid the fly.

Question 36 · 2 pts

Scientists have noticed that crickets with the mutation are still able to attract mates. Based on the data (see question 35 for the data table), which prediction is valid if this particular fly remains part of the cricket's environment?

(A) The number of crickets with the mutation will decrease because the trait is beneficial to them.
(B) The number of crickets with the mutation will remain the same because the trait is neither beneficial nor harmful.
(C) The number of crickets with the mutation will increase because the trait gives them an advantage. ✓
(D) The number of crickets with the mutation will increase because the trait is a disadvantage.

Worked solution

$Crickets with the silent-wing mutation are far less likely to be parasitized by the fly (0.8% vs 30%) and can still attract mates.$

$Because the mutation increases survival without sacrificing reproduction, natural selection favors it, so its frequency should increase over generations.$

Answer: The number of crickets with the mutation will increase because the trait gives them an advantage.

Since the mutated crickets survive better and can still reproduce, natural selection will favor an increase in this trait in the population.

Question 37 · 2 pts

For 20 days, two groups of plants, all with stems of the same length, were grown at two different temperatures. These plants normally grow at a temperature of 25°C. All other environmental conditions were the same. The stem lengths of the plants were measured every five days, averaged, and the data recorded in the table below. Length of Stem (mm): Time (days) 1: Plants in A grown at 17°C = 15, Plants in B grown at 27°C = 15 Time (days) 5: A = 25, B = 30 Time (days) 10: A = 42, B = 68 Time (days) 15: A = 54, B = 80 Time (days) 20: A = 71, B = 92 Scientists claimed that plants growing in the Group A experimental setup at 17°C would be likely to survive if the temperature in their natural environment decreased over time to 17°C. Which statement uses data from the table to support this claim?

(A) Plants in A survived growing at 17°C in their experimental setup and would therefore be likely to survive. ✓
(B) Plants in A require less water. This makes them more likely to survive in cooler temperatures.
(C) Plants in B are growing the most rapidly. A temperature of 17°C will not harm them.
(D) Plants in B will survive and will grow faster at the cooler temperature.

Worked solution

$The data table shows Plants in A continued to grow steadily in length (from 15 mm to 71 mm) over the full 20 days at 17°C.$

$Continued growth over time is direct evidence from the table that the plants survived the cooler temperature, supporting the claim.$

Answer: Plants in A survived growing at 17°C in their experimental setup and would therefore be likely to survive.

The only statement that correctly cites the data table (continuous growth of Group A at 17°C over 20 days) as evidence of survival is choice 1; the others reference water use or Group B, which is irrelevant to Group A's survival at 17°C.

Question 38 · 2 pts

Sea Otters at Risk. A single-celled parasite is responsible for the death of a large number of sea otters. Scientists have traced the origin of the parasite to multiple sources, including domestic cat feces. Rain washes some litter box wastes, which contain cat feces, into the ocean kelp forests where sea otters live. Failure to properly dispose of contaminated cat litter is an example of

(A) one way sea otters are negatively affecting large numbers of household pets
(B) how humans are preventing a dangerous parasite from reproducing
(C) a human action that inadvertently could alter the equilibrium in an ecosystem ✓
(D) the release of a substance that could result in a rapid growth of the sea otter population

Worked solution

$Improperly discarded cat litter introduces a parasite into the kelp forest ecosystem, killing sea otters.$

$This unintentional human action disrupts the natural balance (equilibrium) of the kelp forest community, since sea otters are a key part of that ecosystem.$

Answer: a human action that inadvertently could alter the equilibrium in an ecosystem

The scenario describes an unintended human action (improper waste disposal) introducing a harmful parasite that disrupts ecosystem balance, not otters harming pets or population growth.

Question 39 · 2 pts

Lead in the Environment. Soil contaminated with lead is a source of lead exposure in people and is a worldwide health concern. Scientists examined the relationship between exposure to lead in the topsoil and the occurrence of learning difficulties in children. Soil clings to fingers, toys, and other objects. When young children are exposed to lead, they can experience difficulty with remembering, concentrating, and learning. Lead was used as a gasoline additive until 1996, when it was banned. Emissions from cars and trucks resulted in a buildup of lead in the soil along the side of the road. In a recent study, scientists measured the concentration of lead along sections of the interstate highway system. They then compared the levels of lead in the soil along the side of the road with the number of children in the area experiencing cognitive difficulties. The scientists discovered that where the level of lead in the soil is high, the number of children with learning difficulties is also high. In order to support the claim that lead in the soil can result in learning difficulties in children, the scientists should

(A) repeat the study comparing lead levels in the soils near rivers with those near highways
(B) support the passage of laws to eliminate the use of lead additives in gasoline
(C) determine if high soil concentration of other metals, such as iron, causes learning difficulties in children
(D) determine if there is a correlation between high levels of lead in the soil and in the blood of children with learning disabilities ✓

Worked solution

$A correlation between soil lead levels and learning difficulties alone does not prove that lead exposure caused the learning difficulties.$

$Showing that children with learning difficulties also have elevated blood lead levels would provide a direct physiological link supporting the causal claim.$

Answer: determine if there is a correlation between high levels of lead in the soil and in the blood of children with learning disabilities

To strengthen the causal claim, scientists need evidence connecting lead exposure directly to the children (blood lead levels), not just an environmental correlation with an unrelated metal or location.

Question 40 · 2 pts

After discovering where lead levels in the topsoil are high, what could parents do to reduce the chances of learning difficulties in their children?

(A) Provide their children with only organic fruits and vegetables.
(B) Have their children wash their hands after playing outside. ✓
(C) Have their children attend school in a different part of the community where lead levels are lower.
(D) Provide their family physician with information about any genetic disorders in the family.

Worked solution

$Lead exposure occurs when contaminated soil clings to hands and is then ingested (hand-to-mouth contact).$

$Washing hands after outdoor play removes lead-contaminated soil before it can be ingested, directly reducing exposure.$

Answer: Have their children wash their hands after playing outside.

Since lead exposure happens through contact with contaminated soil on hands, regular handwashing is the most direct and practical way to reduce exposure.

Question 41 · 2 pts

Beavers have been migrating north and impacting Arctic ecosystems. By building dams on streams, beavers are creating new bodies of water where there were none. These new bodies of water contribute to the thawing of the frozen permafrost soil, which is a huge natural reservoir of stored greenhouse gases. In a study of beaver dams located on Alaska's Baldwin Peninsula, there was a total of 94 dams in 2010, and by 2019 there was a total of 409 dams. Based on these numbers of beaver dams constructed between 2010 and 2019, a reasonable claim that scientists can make concerning beaver activity in the Arctic is that beavers

(A) are accelerating the rate of global climate change ✓
(B) are producing a more stable Arctic ecosystem through dam-building
(C) have exceeded their carrying capacity in the Arctic
(D) have caused more soil to freeze during the winter months

Worked solution

$The number of beaver dams increased more than fourfold (94 to 409) from 2010 to 2019, creating many new bodies of water.$

$These new water bodies thaw permafrost, releasing stored greenhouse gases, which contributes to accelerating global climate change.$

Answer: are accelerating the rate of global climate change

More dams mean more thawed permafrost releasing greenhouse gases, supporting the claim that beavers are accelerating climate change rather than stabilizing the ecosystem or freezing soil.

Question 42 · 2 pts

White-tailed deer in New York State breed once a year. The timing of the breeding season and birth of offspring is represented in the chart below. White-Tailed Deer Reproductive Cycle Timeline: a timeline from August through July showing the 'Female deer reproductive cycle' spanning roughly September through June, the 'Deer breeding season' spanning roughly August/September through November/December, and 'Birth of offspring' occurring around April/May. Which statement best helps explain why this breeding cycle is successful for deer?

(A) Giving birth in the spring and early summer ensures that there will be food for the offspring. ✓
(B) Deer avoid giving birth during the fall hunting season.
(C) Fall is the only time of the year male and female deer are in the same locations.
(D) Large deer predators move to cooler locations during the hot summer months.

Worked solution

$The timeline shows breeding occurs in fall (Aug to Dec) and, after a gestation period, offspring are born in spring/early summer.$

$Spring and early summer bring new plant growth, providing abundant food for the mother and newborn fawns, increasing offspring survival.$

Answer: Giving birth in the spring and early summer ensures that there will be food for the offspring.

Timing birth to coincide with spring plant growth maximizes food availability for the doe and fawn, which is the adaptive advantage of this breeding cycle.

Question 43 · 2 pts

The diagram below represents human body cells and their interactions with the hormone, insulin. It shows two conditions, 'Normal' and 'Insulin Resistance.' In the Normal condition, insulin binds to body cells and glucose moves from the bloodstream into the body cells. In the Insulin Resistance condition, insulin is present but body cells do not respond, and glucose remains in the bloodstream rather than entering the cells. Insulin resistance results when the body produces insulin but cells are not able to respond to it. This resistance could result in

(A) a lower level of glucose in the bloodstream
(B) an increase of glucose in the cell
(C) a failure of glucose to leave the cells
(D) an increase of glucose in the bloodstream ✓

Worked solution

$Insulin normally signals body cells to take up glucose from the bloodstream.$

$If cells cannot respond to insulin (insulin resistance), glucose cannot enter the cells and instead accumulates in the bloodstream.$

Answer: an increase of glucose in the bloodstream

Because insulin resistance blocks glucose uptake into cells, glucose builds up in the blood rather than decreasing or entering cells.

Question 44 · 1 pt · constructed response

Base your answer on the information below and on your knowledge of biology. Why Do Marimo Balls Float and Sink? Marimo are fuzzy, round balls of a rare algae that is native to some cold, freshwater lakes. They have been observed to float after dawn and sink after dusk. A group of scientists conducted experiments to determine the cause of this floating and sinking action. In one experiment, a marimo ball was placed in a graduated cylinder with 500 mL of water and exposed to light for four minutes. After four minutes, the light was turned off and the marimo was kept in the dark for another four minutes. The position of the marimo was measured each minute by recording the location of the marimo in the graduated cylinder with respect to the mL lines. Marimo Position in Light and Dark Conditions data table: Light on, Time = 1 min, Position = 100 mL Light on, Time = 2 min, Position = 225 mL Light on, Time = 3 min, Position = 500 mL Light on, Time = 4 min, Position = 500 mL Light off, Time = 5 min, Position = 500 mL Light off, Time = 6 min, Position = 425 mL Light off, Time = 7 min, Position = 200 mL Light off, Time = 8 min, Position = 100 mL Directions (44-45): Using the information given in the data table, construct a line graph on the grid provided, following the instructions below. 44 Mark an appropriate scale, without any breaks in the data, on each labeled axis.

Model answer: X-axis (Time, minutes): label evenly spaced increments from 0 to 8 (e.g., 0,1,2,3,4,5,6,7,8), one grid space per minute. Y-axis (Position, mL line): label evenly spaced increments from 0 to 500 in equal intervals (e.g., 0,100,200,300,400,500), with no breaks, so all data points (ranging from 100 to 500 mL) fit on the grid.

Worked solution

$The time data range from 1 to 8 minutes, so the x-axis should be scaled in equal increments (such as 1 unit per grid square) starting at 0 and extending to at least 8.$

$The position data range from 100 to 500 mL, so the y-axis should be scaled in equal increments (such as 50 or 100 mL per interval) starting at 0 and extending to at least 500, with no breaks in the scale.$

$Both axes must use a single, consistent, evenly spaced scale across their full length so that every data point can be plotted accurately.$ General scaling rule for Regents graphing questions

Answer: X-axis (Time, minutes): label evenly spaced increments from 0 to 8 (e.g., 0,1,2,3,4,5,6,7,8), one grid space per minute. Y-axis (Position, mL line): label evenly spaced increments from 0 to 500 in equal intervals (e.g., 0,100,200,300,400,500), with no breaks, so all data points (ranging from 100 to 500 mL) fit on the grid.

An appropriate scale evenly divides each axis into equal intervals that span the full range of the recorded data (0 to 8 minutes; 0 to 500 mL) without skipping or compressing any values.

Question 45 · 1 pt · constructed response

Directions (44-45): Using the information given in the data table, construct a line graph on the grid provided, following the instructions below. 45 Plot the data on the grid provided. Connect the points and surround each point with a small circle. Data table (Marimo Position in Light and Dark Conditions): Light on: Time 1 min, Position 100 mL; Time 2 min, Position 225 mL; Time 3 min, Position 500 mL; Time 4 min, Position 500 mL. Light off: Time 5 min, Position 500 mL; Time 6 min, Position 425 mL; Time 7 min, Position 200 mL; Time 8 min, Position 100 mL.

Model answer: Plot the eight points (1,100), (2,225), (3,500), (4,500), (5,500), (6,425), (7,200), (8,100) on the grid using the scale established in question 44, surround each point with a small circle, and connect the points in order with straight line segments, matching the example shown.

Worked solution

$\text{Points: } (1,100),(2,225),(3,500),(4,500),(5,500),(6,425),(7,200),(8,100)$

$\text{Circle each point and connect sequentially with straight lines, as in the example.}$

Answer: Plot the eight points (1,100), (2,225), (3,500), (4,500), (5,500), (6,425), (7,200), (8,100) on the grid using the scale established in question 44, surround each point with a small circle, and connect the points in order with straight line segments, matching the example shown.

This is a graphing task: each data point from the table must be plotted, circled, and connected in sequence to visually represent the marimo's rise during the light period and fall during the dark period.

Question 46 · 1 pt · constructed response

State the relationship between the light exposure and the position of the marimo balls.

Model answer: When light is on, the marimo balls rise/float upward in the cylinder (position value increases toward the top); when the light is turned off (dark), the marimo balls sink/fall downward (position value decreases).

Worked solution

$\text{Light on (min 1-4): position rises } 100 \to 225 \to 500 \to 500$

$\text{Light off (min 5-8): position falls } 500 \to 425 \to 200 \to 100$

Answer: When light is on, the marimo balls rise/float upward in the cylinder (position value increases toward the top); when the light is turned off (dark), the marimo balls sink/fall downward (position value decreases).

The data table shows the marimo's position increases (rises/floats) during light exposure and decreases (sinks) once the light is turned off, showing floating is linked to light-driven photosynthesis.

Question 47 · 2 pts

The scientists observed that when the marimo were floating, they were covered with tiny bubbles. They hypothesized that these bubbles were products of photosynthesis. Therefore, the bubbles were most likely

(A) carbon dioxide
(B) hydrogen
(C) glucose
(D) oxygen ✓

Worked solution

$\text{Photosynthesis: } 6CO_2 + 6H_2O \xrightarrow{light} C_6H_{12}O_6 + 6O_2$

$\text{Gas bubbles released during photosynthesis are oxygen gas.}$

Answer: oxygen

Photosynthesis produces oxygen gas as a byproduct, which is released as bubbles; glucose is not a gas and carbon dioxide/hydrogen are not products of photosynthesis.

Question 48 · 1 pt · constructed response

Describe one advantage to the marimo algal balls having the ability to float during the day.

Model answer: Floating brings the marimo closer to the surface of the water where light intensity is greatest, allowing them to carry out photosynthesis more efficiently and produce more food/energy during the day.

Worked solution

$\text{Closer to surface} \Rightarrow \text{more light absorbed} \Rightarrow \text{increased rate of photosynthesis}$

Answer: Floating brings the marimo closer to the surface of the water where light intensity is greatest, allowing them to carry out photosynthesis more efficiently and produce more food/energy during the day.

Being near the surface during daylight maximizes light exposure needed for photosynthesis, giving the marimo a survival/energy advantage.

Question 49 · 2 pts

In order to determine if the floating of marimo was due to photosynthesis, the scientists treated them with DCMU, a chemical that prevents cells from carrying out photosynthesis. The DCMU-treated marimo were exposed to light continuously for 48 hours. No bubbles were observed on the surface of the treated marimo and they did not float. Based on these results, scientists can conclude that

(A) gas released during photosynthesis causes marimo to float ✓
(B) warmer temperatures cause marimo to float
(C) photosynthesis is not responsible for marimo floating
(D) DCMU treatment increases the ability to float

Worked solution

$\text{Blocking photosynthesis (DCMU)} \Rightarrow \text{no bubbles, no floating}$

$\therefore \text{gas (O}_2\text{) from photosynthesis is responsible for floating}$

Answer: gas released during photosynthesis causes marimo to float

Since blocking photosynthesis eliminated both bubble formation and floating, the gas produced by photosynthesis (oxygen) must be the cause of floating.

Question 50 · 2 pts

Which inference is reasonable, based on the data in the graph?

(A) Spruce grouse, which inhabit spruce forests, became more common over the years. ✓
(B) Mice and other grassland species remained abundant in the area for many years.
(C) Birds living in this area in 1995 preferred shrub habitats over heavily wooded habitats.
(D) Birch trees are likely the most common type of tree species in the area today.

Worked solution

$\text{Graph: grasses/shrubs decline early; birch peaks mid-succession; spruce increases toward 1995 and beyond}$

$\text{More spruce trees} \Rightarrow \text{more habitat for spruce-dependent species (spruce grouse)}$

Answer: Spruce grouse, which inhabit spruce forests, became more common over the years.

As succession proceeded, spruce trees increased in relative mass, which would support an increase in species like spruce grouse that depend on spruce forest habitat.

Question 51 · 1 pt · constructed response

Describe how the graph would likely appear 20 or more years after 1995 if the study had continued. Support your answer.

Model answer: The graph would likely show spruce trees continuing to increase and becoming the dominant species (with maple also relatively abundant), while birch trees, shrubs, and grasses would continue to decline toward very low levels, because ecological succession proceeds toward a stable climax community dominated by long-lived, shade-tolerant trees like spruce.

Worked solution

$\text{Succession trend: grasses/shrubs} \to \text{birch (early successional)} \to \text{spruce/maple (climax species)}$

$\text{Extrapolating the curve, spruce mass continues rising, birch mass continues falling}$

Answer: The graph would likely show spruce trees continuing to increase and becoming the dominant species (with maple also relatively abundant), while birch trees, shrubs, and grasses would continue to decline toward very low levels, because ecological succession proceeds toward a stable climax community dominated by long-lived, shade-tolerant trees like spruce.

The data show a classic successional pattern; extending the trend, spruce (a climax species) would keep increasing while earlier successional species (birch, shrubs, grasses) would keep decreasing.

Question 52 · 1 pt · constructed response

The diagrams below represent parts of the human male and female reproductive systems, with structures labeled A, B, C, D in each diagram. In the male reproductive system diagram, A labels the testis (oval structure at the bottom). In the female reproductive system diagram, A labels the ovary (oval structure at the end of the tube containing egg cells). 52 Identify one process carried out by both structures labeled A.

Model answer: Both structures labeled A (the testis and the ovary) produce sex cells/gametes (sperm and eggs); they also both produce sex hormones.

Worked solution

$\text{Testis: produces sperm and testosterone}$

$\text{Ovary: produces eggs and estrogen}$

$\text{Shared process: gamete production (and/or hormone production)}$

Answer: Both structures labeled A (the testis and the ovary) produce sex cells/gametes (sperm and eggs); they also both produce sex hormones.

Both the testis and ovary are gonads that produce gametes (sperm/eggs) via meiosis and also secrete sex hormones.

Question 53 · 1 pt · constructed response

The diagram below represents the carrying capacities of an ecosystem for three different species (1, 2, and 3) and the relative population sizes for each species in the area, shown as a bar graph with a key distinguishing 'Carrying capacity' bars (white) from 'Actual population size' bars (gray). For Species 1, the carrying-capacity bar is tall and the actual-population bar is much shorter. For Species 2, the carrying-capacity bar is shorter than its actual-population bar, which is the tallest bar shown. For Species 3, both bars are short and roughly similar in height. 53 Which species is most likely to undergo a population increase in the future? Support your answer.

Model answer: Species 1 is most likely to increase, because its actual population size is well below its carrying capacity, meaning there are enough resources available in the ecosystem to support additional growth.

Worked solution

$\text{Species 1: actual population} \ll \text{carrying capacity} \Rightarrow \text{room to grow}$

$\text{Species 2: actual population} > \text{carrying capacity} \Rightarrow \text{likely to decrease}$

Answer: Species 1 is most likely to increase, because its actual population size is well below its carrying capacity, meaning there are enough resources available in the ecosystem to support additional growth.

A population below its carrying capacity has available resources (food, space) to support further growth, making an increase likely for Species 1.

Question 54 · 1 pt · constructed response

The diagram below represents the active transport of molecules of A through a portion of a cell membrane, labeled 'Active Transport.' It shows a transport protein moving molecules of A from a region where they are less concentrated (few molecules of A outside) to a region where they become more concentrated (many molecules of A accumulate on the other side), with an 'Energy Use' label at the transport protein. 54 Explain why this diagram is labeled "Active Transport."

Model answer: The diagram is labeled active transport because molecules of A are being moved across the membrane from an area of lower concentration to an area of higher concentration, that is, against the concentration gradient, which requires the cell to use energy (as shown by the 'Energy Use' label), unlike passive diffusion.

Worked solution

$\text{Molecules move low} \to \text{high concentration (against gradient)}$

$\text{Movement against gradient requires ATP/energy input}$

Answer: The diagram is labeled active transport because molecules of A are being moved across the membrane from an area of lower concentration to an area of higher concentration, that is, against the concentration gradient, which requires the cell to use energy (as shown by the 'Energy Use' label), unlike passive diffusion.

Movement of a substance against its concentration gradient always requires energy, which is the defining feature of active transport.

Question 55 · 1 pt · constructed response

The "Energy Use" label involves a specific molecule produced by this cell. Identify this molecule and a cellular process that produces it.

Model answer: The molecule is ATP, and it is produced by the process of cellular respiration (which occurs in the mitochondria).

Worked solution

$\text{Energy for active transport} = ATP$

$ATP \text{ is produced by cellular respiration}$

Answer: The molecule is ATP, and it is produced by the process of cellular respiration (which occurs in the mitochondria).

ATP is the energy molecule cells use to power active transport, and it is generated through cellular respiration.

Question 56 · 1 pt · constructed response

Why Honey Badgers Don't Care. The honey badger, found in parts of India, Africa, and the Middle East, has been identified as "the world's most fearless creature" by the Guinness Book of World Records. Although they are primarily carnivorous, honey badgers consume a wide variety of food: rodents, insects, bee larvae, birds, and fruit. Venomous snakes, including cobras and puff adders, are also favorite items on their menu. As much as 25% of a honey badger's diet consists of venomous snakes with fangs. The adaptation to withstand snake venom has enabled them to be one of the only predators to feast on this source of meat. They hunt fairly slow-moving prey with fangs rather than fast prey with claws and teeth. Snake venom contains more than 100 proteins that could potentially poison a honey badger, meaning that honey badgers need multiple defenses. Scientists have focused their research on a nasty class of molecules in cobra venom called alpha-neurotoxins, that paralyze the muscles associated with breathing. These neurotoxins block a specific receptor and therefore prevent muscle cells from receiving signals from the nervous system. Presently, most antivenoms used to treat snake bites are made of proteins produced by the immune systems of horses and sheep exposed to specific snake venoms. These proteins attack the venom directly in people bitten by a venomous snake. 56 Explain how the ability of honey badgers to eat venomous snakes is an example of a favorable adaptation.

Model answer: Because honey badgers can resist snake venom, they are able to safely prey on venomous snakes as a food source that most other predators cannot use, giving them access to more food/less competition, which increases their chances of survival and successful reproduction, allowing this trait to be passed on to future generations.

Worked solution

$\text{Venom resistance} \Rightarrow \text{access to a food source unavailable to competitors}$

$\text{More food/survival} \Rightarrow \text{greater reproductive success} \Rightarrow \text{trait passed to offspring}$

Answer: Because honey badgers can resist snake venom, they are able to safely prey on venomous snakes as a food source that most other predators cannot use, giving them access to more food/less competition, which increases their chances of survival and successful reproduction, allowing this trait to be passed on to future generations.

A favorable adaptation increases an organism's chance of survival and reproduction; venom resistance lets honey badgers exploit a unique food source, boosting their fitness.

Question 57 · 1 pt · constructed response

State why using an antivenom made from horse proteins could result in an allergic reaction.

Model answer: Horse proteins are foreign molecules (antigens) to the human body, so a person's immune system may recognize them as non-self and mount an immune/allergic response against them.

Worked solution

$\text{Horse proteins} = \text{foreign antigens to human immune system}$

$\text{Immune system recognizes non-self proteins} \Rightarrow \text{allergic/immune response}$

Answer: Horse proteins are foreign molecules (antigens) to the human body, so a person's immune system may recognize them as non-self and mount an immune/allergic response against them.

The immune system can react to any foreign protein it doesn't recognize as part of the body, triggering an allergic reaction, which is why horse-derived antivenom proteins can cause this response in humans.

Question 58 · 1 pt · constructed response

Three Billion North American Birds Have Vanished Since 1970. Recent surveys of 529 bird species revealed that since 1970 the North American continent lost 3 billion birds, 29% of the total. Birds are excellent indicators of environmental health and are vital to ecosystems. Common bird species control insects, pollinate flowers, spread seeds, and help regenerate forests. As a result, when these birds disappear, their former habitats are not the same. 58 Explain why the decline in some North American bird populations is having a negative effect on ecosystems.

Model answer: Birds perform important ecological roles such as controlling insect populations, pollinating flowers, and dispersing seeds; as bird populations decline, these functions are lost, which can lead to increases in insect pest populations, reduced pollination and seed dispersal, and disrupted forest regeneration, upsetting the balance of the ecosystem.

Worked solution

$\text{Birds control insects, pollinate flowers, spread seeds}$

$\text{Fewer birds} \Rightarrow \text{loss of these services} \Rightarrow \text{ecosystem imbalance}$

Answer: Birds perform important ecological roles such as controlling insect populations, pollinating flowers, and dispersing seeds; as bird populations decline, these functions are lost, which can lead to increases in insect pest populations, reduced pollination and seed dispersal, and disrupted forest regeneration, upsetting the balance of the ecosystem.

Since birds provide key ecological services, their decline removes checks on insect populations and reduces pollination/seed dispersal, harming overall ecosystem stability.

Question 59 · 1 pt · constructed response

Identify the habitat that has had the greatest decline in birds since 1970, and describe a cause of the loss of birds in that habitat.

Model answer: Grassland habitats have had the greatest decline in birds. A cause of this loss is the conversion of grasslands into farmland (habitat loss/destruction due to agriculture), and/or the use of pesticides that reduce insect food sources.

Worked solution

$\text{Grassland bar shows largest percent decline (approx.} -50\%\text{)}$

$\text{Cause: conversion of grassland to farmland / pesticide use}$

Answer: Grassland habitats have had the greatest decline in birds. A cause of this loss is the conversion of grasslands into farmland (habitat loss/destruction due to agriculture), and/or the use of pesticides that reduce insect food sources.

The bar graph shows grassland habitats with the steepest decline, and the passage identifies converting grasslands into farmland and pesticide use as major causes.

Question 60 · 1 pt · constructed response

The bobolink is a small blackbird whose population has undergone a decline of 75% in some regions. These birds nest in fields of tall grass during the summer across the northern United States and migrate long distances to winter in southern South America. 60 Describe an action people might take that could reduce the decline in the bobolink population.

Model answer: People could delay mowing hayfields/tall grass fields until after the bobolink nesting season is over, or preserve/protect grassland habitat from being converted to farmland, to give bobolinks a safe place to nest and raise young.

Worked solution

$\text{Bobolinks nest in tall grass fields}$

$\text{Preserving grassland/delaying mowing} \Rightarrow \text{protects nests} \Rightarrow \text{supports population recovery}$

Answer: People could delay mowing hayfields/tall grass fields until after the bobolink nesting season is over, or preserve/protect grassland habitat from being converted to farmland, to give bobolinks a safe place to nest and raise young.

Protecting the tall-grass nesting habitat, such as by timing hay mowing after nesting season, reduces destruction of nests and helps sustain the bobolink population.

Question 61 · 1 pt · constructed response

New research comparing the anatomy and behavior of dogs and wolves found that dogs have small facial muscles around their eyes which allow them to raise their inner eyebrow. This makes their eyes appear larger and more infant-like. Wolves do not have these muscles. Scientists hypothesize that dogs expressing this "puppy-dog eye" trait unconsciously stimulate a desire in humans to take care of them. Examine the evolutionary tree (cladogram) of modern dogs and their relatives below, titled 'Canine Evolution,' branching in order from the most recent branch point down to the base: Modern dog, Gray wolf, Coyote, African golden wolf, Golden jackal, Ethiopian wolf, Asian wolf, African wild dog, Side-striped jackal, Black-backed jackal. 61 According to the evolutionary tree, identify which species, the African golden wolf or the modern dog, is most closely related to the gray wolf. Support your answer with evidence from the evolutionary tree.

Model answer: The modern dog is most closely related to the gray wolf, because on the evolutionary tree the branch point (node) joining modern dog and gray wolf is more recent (closer to the tips of the tree) than the branch point joining gray wolf and African golden wolf, indicating modern dog and gray wolf share a more recent common ancestor.

Worked solution

$\text{Closer branch point} = \text{more recent common ancestor} = \text{closer relationship}$

$\text{Modern dog and gray wolf share the most recent node on the tree}$

Answer: The modern dog is most closely related to the gray wolf, because on the evolutionary tree the branch point (node) joining modern dog and gray wolf is more recent (closer to the tips of the tree) than the branch point joining gray wolf and African golden wolf, indicating modern dog and gray wolf share a more recent common ancestor.

In a cladogram, species that share the most recent common ancestor (closest branch point) are the most closely related; the modern dog branches off closest to the gray wolf.

Question 62 · 1 pt · constructed response

Explain how genes for a trait such as puppy-dog eyes in domesticated dogs could have increased in frequency over time.

Model answer: Dogs that displayed the puppy-dog eye trait were more likely to elicit caretaking behavior from humans, making humans more likely to feed, protect, and breed them (selection by humans). These dogs therefore survived and reproduced more successfully than dogs without the trait, passing the gene for the trait to more offspring, which increased its frequency in the population over many generations.

Worked solution

$\text{Trait} \Rightarrow \text{increased human care/selection}$

$\text{Increased survival/reproduction of trait-carriers} \Rightarrow \text{allele frequency increases over generations}$

Answer: Dogs that displayed the puppy-dog eye trait were more likely to elicit caretaking behavior from humans, making humans more likely to feed, protect, and breed them (selection by humans). These dogs therefore survived and reproduced more successfully than dogs without the trait, passing the gene for the trait to more offspring, which increased its frequency in the population over many generations.

This is an example of selection (here, driven by human preference) where individuals with a favorable trait reproduce more successfully, increasing the trait's frequency in the population over time.

Question 63 · 1 pt · constructed response

Breaking Down Plastics. Researchers collected soil contaminated with specific plastics outside a plastic bottle recycling facility. They discovered a type of bacterium in the soil that was able to depolymerize (break down) and use these plastics as a source of nutrition. A bacterial enzyme that could digest large molecules of plastic into their building blocks was isolated. Those building blocks can be used to produce new plastic products. Scientists have been working to improve the efficiency of this enzyme by altering the specific molecules the bacteria need to code for the synthesis of the enzyme. Using this method, many variations of the enzyme were produced by the altered bacteria, and these variants were tested. The graphs below show a comparison of the activity of the original enzyme and two variants produced by the scientists. Graph 1, 'Original Enzyme,' shows Depolymerization (%) rising from 0 to about 32-35% over 6 days. Graph 2, 'Two Variations of Enzymes,' shows Variant 1 enzyme and Variant 2 enzyme both rising to about 90% depolymerization within about 12-24 hours. 63 Using evidence from the graphs, support the claim that the scientists were successful in developing a more efficient enzyme.

Model answer: The original enzyme only reached about 30-35% depolymerization after 6 days (144 hours), while the variant enzymes reached about 90% depolymerization in just 24 hours or less, showing the variant enzymes broke down much more plastic in far less time, demonstrating that the scientists successfully developed a more efficient enzyme.

Worked solution

$\text{Original enzyme: } \approx 32\%\text{ depolymerization after } 6\text{ days} = 144\text{ hours}$

$\text{Variant enzymes: } \approx 90\%\text{ depolymerization within } \le 24\text{ hours}$

$\text{Higher \% in much less time} \Rightarrow \text{greater efficiency}$

Answer: The original enzyme only reached about 30-35% depolymerization after 6 days (144 hours), while the variant enzymes reached about 90% depolymerization in just 24 hours or less, showing the variant enzymes broke down much more plastic in far less time, demonstrating that the scientists successfully developed a more efficient enzyme.

Efficiency is measured by how much plastic is broken down and how quickly; the variant enzymes achieved a much higher percent depolymerization in a much shorter time than the original enzyme.

Question 64 · 1 pt · constructed response

Describe a technique the scientists most likely would use to alter the specific molecules in the bacteria referred to in the reading.

Scientists are studying a species of bacteria that naturally produces an enzyme. Like all enzymes, this enzyme is a protein built from a specific sequence of amino acids, and that sequence is coded for by a specific gene in the bacteria's DNA. The researchers want to produce variant forms of the enzyme that have slightly different amino acid sequences so they can test which version works best. To make these variants, they need to change the specific gene in the bacteria that codes for the enzyme.

Model answer: The scientists most likely used genetic engineering/gene editing techniques, such as CRISPR-Cas9, to directly alter or insert genes (DNA) in the bacteria so that the bacteria would produce enzyme variants with different amino acid sequences.

Worked solution

$\text{Enzyme structure is coded by DNA/genes}$

$\text{Altering the gene sequence (genetic engineering, e.g., CRISPR)} \Rightarrow \text{altered enzyme}$

Answer: The scientists most likely used genetic engineering/gene editing techniques, such as CRISPR-Cas9, to directly alter or insert genes (DNA) in the bacteria so that the bacteria would produce enzyme variants with different amino acid sequences.

Since enzymes are proteins coded for by genes, scientists would use a genetic engineering technique (like CRISPR gene editing) to change the DNA sequence coding for the enzyme, producing variant enzymes.

Question 65 · 1 pt · constructed response

Explain how using these modified enzymes can benefit the environment.

Model answer: The modified enzymes can break down plastic waste more quickly and efficiently, reducing the buildup of plastic pollution in landfills and natural environments such as oceans, and the building blocks produced can be recycled into new plastic products, reducing the need for new raw materials and decreasing overall plastic waste and pollution.

Worked solution

$\text{More efficient enzyme} \Rightarrow \text{faster/greater breakdown of plastic waste}$

$\text{Less plastic waste in environment} + \text{recyclable building blocks} \Rightarrow \text{reduced pollution}$

Answer: The modified enzymes can break down plastic waste more quickly and efficiently, reducing the buildup of plastic pollution in landfills and natural environments such as oceans, and the building blocks produced can be recycled into new plastic products, reducing the need for new raw materials and decreasing overall plastic waste and pollution.

A faster, more efficient plastic-digesting enzyme reduces the amount of plastic waste polluting the environment and allows the breakdown products to be reused, benefiting the environment.

Question 66 · 1 pt · constructed response

Explain why these enzymes will break down specific plastics but not react with other substances.

Model answer: Enzymes are specific because their active site has a shape that is complementary only to the shape of the particular plastic molecule (substrate) they act on; other substances have different molecular shapes that do not fit the enzyme's active site, so the enzyme cannot bind to or break down those other substances.

Worked solution

$\text{Enzyme active site shape} \leftrightarrow \text{specific substrate shape (lock-and-key/induced fit)}$

$\text{Non-matching substances} \Rightarrow \text{no binding} \Rightarrow \text{no reaction}$

Answer: Enzymes are specific because their active site has a shape that is complementary only to the shape of the particular plastic molecule (substrate) they act on; other substances have different molecular shapes that do not fit the enzyme's active site, so the enzyme cannot bind to or break down those other substances.

Enzyme specificity arises from the complementary shape between an enzyme's active site and its particular substrate, so only molecules matching that shape (the target plastic) will bind and react.

Question 67 · 1 pt · constructed response

Base your answers to questions 67 through 69 on the partial Arizona desert food web represented below and on your knowledge of biology. Desert food webs are complex and often contain more food chains than a grassland or forest food web. This is important to the stability of the desert ecosystem. Relationships between organisms can be described as positive, negative, or neutral. Positive relationship: Both species benefit. Negative relationship: Either species would benefit if the other species were no longer present. Neutral relationship: The species have no effect on each other. 67 Identify the type of relationship between the collared lizard and the grasshopper mouse as positive, negative, or neutral. Support your answer with information from the food web.

Model answer: Negative relationship, because both the collared lizard and the grasshopper mouse feed on the pallid-winged grasshopper (and other shared prey/producers). Since they compete for the same limited food source, either species would benefit if the other were no longer present.

Worked solution

$Trace the arrows leading into the collared lizard and into the grasshopper mouse on the food web.$ Identify shared food sources

$Both organisms have an arrow coming from the pallid-winged grasshopper, showing they eat the same prey.$

$Organisms that rely on the same limited food source are in competition, which is a negative relationship.$

Answer: Negative relationship, because both the collared lizard and the grasshopper mouse feed on the pallid-winged grasshopper (and other shared prey/producers). Since they compete for the same limited food source, either species would benefit if the other were no longer present.

Two consumers that feed on the same prey species are competitors; removing one would free up more of the shared food source for the other, fitting the definition of a negative relationship.

Question 68 · 1 pt · constructed response

People often want to remove top-level predators from an ecosystem. There are a number of reasons for this, depending on the area and the predator. Explain how removing the red-tailed hawk would affect the prickly pear cactus population in this food web. Support your answer with information from the food web.

Model answer: If the red-tailed hawk were removed, the populations of the animals it preys on (such as the antelope squirrel and wood rat, which feed on the prickly pear cactus) would increase because they are no longer being eaten by the hawk. These larger populations of squirrels and rats would consume more of the prickly pear cactus, causing its population to decrease.

Worked solution

$Identify the organisms the red-tailed hawk preys on in the food web (e.g., antelope squirrel, wood rat, collared lizard, grasshopper mouse, rattlesnake).$

$Removing the predator allows those prey populations to increase due to reduced predation pressure.$

$Antelope squirrel and wood rat feed on the prickly pear cactus, so their increased numbers lead to more consumption of the cactus, decreasing its population.$

Answer: If the red-tailed hawk were removed, the populations of the animals it preys on (such as the antelope squirrel and wood rat, which feed on the prickly pear cactus) would increase because they are no longer being eaten by the hawk. These larger populations of squirrels and rats would consume more of the prickly pear cactus, causing its population to decrease.

Removing a top predator triggers a trophic cascade: prey populations grow unchecked and increase pressure on the producers those prey consume.

Question 69 · 1 pt · constructed response

One group of students drew energy pyramid A to model where the energy is located in the Arizona desert food web. Another group of students drew energy pyramid B for their model. 69 If energy pyramid B actually represents what is happening in that area of the desert, explain what would eventually happen and why.

Model answer: The organisms at the upper trophic levels would eventually die off or decrease sharply in number (population crash) because there is not enough available energy/biomass being produced by the producers and lower levels to support the unusually large populations above them.

Worked solution

$In pyramid B, the upper levels are shown as larger than what the producer/lower levels can supply.$

$Only about 10% of energy transfers from one trophic level to the next, so upper levels can normally only be a fraction of the level below.$

$If the upper levels are actually larger than the energy available, organisms at the top will not have enough food/energy and their populations will decline until the pyramid becomes a stable, normal (wide-based) shape like A.$

Answer: The organisms at the upper trophic levels would eventually die off or decrease sharply in number (population crash) because there is not enough available energy/biomass being produced by the producers and lower levels to support the unusually large populations above them.

An inverted or top-heavy energy pyramid is unsustainable because energy availability decreases at each higher trophic level; without enough energy input from below, upper-level populations must decrease.

Question 70 · 1 pt · constructed response

In 1980 the red wolf was declared extinct in the wild. Only one small captive population survives in North Carolina. Recently a group of canines resembling coyotes but with red fur were discovered on an island near Texas. They are clearly a kind of coyote, but could possibly contain some red wolf genetic material. 70 Scientists suggest that breeding the red-coated coyotes that might contain genetic material could help increase diversity within the existing red wolf population in North Carolina. Explain why increasing the diversity in the red wolf population could be beneficial to the species.

Model answer: Increasing genetic diversity gives the red wolf population a greater variety of traits, which increases the chance that some individuals will have traits allowing them to survive environmental changes, disease, or other challenges, reducing the risk of the species becoming extinct. It also reduces problems associated with inbreeding in a small, isolated population.

Worked solution

$A small captive population has limited genetic variation, increasing risk of inbreeding depression.$

$Adding new genetic material introduces new alleles/traits into the population.$

$Greater variation increases the odds that some individuals possess traits suited to survive future environmental changes or disease, improving the long-term survival of the species.$

Answer: Increasing genetic diversity gives the red wolf population a greater variety of traits, which increases the chance that some individuals will have traits allowing them to survive environmental changes, disease, or other challenges, reducing the risk of the species becoming extinct. It also reduces problems associated with inbreeding in a small, isolated population.

Genetic diversity is the raw material for natural selection; a more diverse population is more resilient to environmental change and less vulnerable to the negative effects of inbreeding.

Question 71 · 1 pt · constructed response

Base your answers to questions 71 and 72 on the information below and on your knowledge of biology. A cat owner was devastated by the death of his beloved cat, Garlic. He contacted a cloning company that was able to produce Garlic 2.0 using DNA from preserved cells of the original cat. However, the client was disappointed to see that while Garlic 2.0 was very similar to his original pet, there were slight differences in the cloned cat's appearance. 71 Other than age or an error in the cloning process, describe one factor that could have led to the differences observed in Garlic 2.0, as compared to the original cat.

Model answer: Differences in the environment during development (such as the conditions in the womb of the surrogate mother, nutrition, or other environmental factors) can affect gene expression and cause differences in appearance, even though the genetic material is identical.

Worked solution

$Cloning copies the nuclear DNA, but it does not guarantee an identical environment during development.$

$Environmental factors (diet, temperature, conditions in the surrogate's uterus, or random developmental variation) can influence how genes are expressed, affecting traits like coat color/pattern.$

Answer: Differences in the environment during development (such as the conditions in the womb of the surrogate mother, nutrition, or other environmental factors) can affect gene expression and cause differences in appearance, even though the genetic material is identical.

Genetically identical organisms can still show phenotypic differences because gene expression is influenced by environmental conditions during development, not just the underlying DNA sequence.

Question 72 · 1 pt · constructed response

The embryo that became Garlic 2.0 was implanted into another cat, a surrogate mother. 72 Explain why scientists claimed that the surrogate mother did not determine the genetic makeup of the Garlic 2.0 embryo.

Model answer: The surrogate mother only provided the uterus/environment in which the cloned embryo developed; she did not contribute any of her own DNA or genetic material to the embryo. The embryo's DNA came entirely from the nucleus of the original cat's preserved cells, so the surrogate had no genetic influence on Garlic 2.0.

Worked solution

$In cloning, the nucleus (containing DNA) from a donor cell (Garlic) is used to create the embryo.$

$The surrogate mother's role is to carry and give birth to the embryo, not to supply genetic material.$

$Since none of the surrogate's DNA was combined with the embryo, she could not have determined its genetic makeup.$

Answer: The surrogate mother only provided the uterus/environment in which the cloned embryo developed; she did not contribute any of her own DNA or genetic material to the embryo. The embryo's DNA came entirely from the nucleus of the original cat's preserved cells, so the surrogate had no genetic influence on Garlic 2.0.

Surrogacy involves gestation only; the genetic information of a clone comes solely from the donor nucleus, not from the surrogate that carries the pregnancy.

Question 73 · 2 pts

Lemurs of Madagascar Lemurs are primates found only on the island of Madagascar, which is located about 250 miles off the coast of Africa. The ancestral species of lemurs arrived 40-50 million years ago (mya), long after Madagascar became an island. Since the arrival of the single ancestral species on Madagascar, there are now over 100 species of lemurs. Which statement is a likely explanation for the current diversity of lemurs?

(A) Genetic variation was limited because they were living on an island.
(B) There were no natural predators and many available niches. ✓
(C) Competition between lemurs stopped natural selection.
(D) Habitats were destroyed after the arrival of humans.

Worked solution

$A single ancestral species reaching an isolated island with open niches and few/no predators can undergo adaptive radiation.$

$With many unoccupied niches available, different populations adapt to different resources/environments over time, leading to speciation.$

$This produces many descendant species from one ancestor, matching the over 100 lemur species seen today.$

Answer: There were no natural predators and many available niches.

Isolation on an island with abundant unfilled niches and no natural predators allows a single founding species to diversify rapidly into many species through adaptive radiation.

Question 74 · 2 pts

Which is an example of physical evidence that could be used to support a possible evolutionary relationship among lemur species?

(A) similar amino acids
(B) similar social behaviors
(C) similar food choices
(D) similar skeletal structures ✓

Worked solution

$Physical (anatomical) evidence of evolutionary relationships includes structural similarities such as bone/skeletal structure (homologous structures).$

$Behavior and food choices are not physical/structural evidence; amino acid similarity is molecular, not physical/anatomical, evidence.$

Answer: similar skeletal structures

Homologous skeletal structures are classic physical evidence used to infer evolutionary relatedness among species, unlike behavioral or molecular comparisons.

Question 75 · 2 pts

Drastic environmental changes are occurring on an island. Which graph below best represents the variation in finch beak sizes that would most likely provide the greatest chance for survival?

(A) Graph (1): narrow tall peak centered around 8mm beak depth
(B) Graph (2): broad peak spanning about 6mm to 14mm beak depth, centered near 10-11mm ✓
(C) Graph (3): peak centered around 13mm beak depth
(D) Graph (4): narrower peak centered around 9-10mm beak depth

Worked solution

$Under drastic environmental change, a population with greater variation in a trait has more individuals with traits suited to the new conditions.$

$The graph with the widest spread of beak sizes (graph 2) represents the greatest genetic variation in the population.$

$Greater variation increases the chance that some finches will survive and reproduce under changing conditions, compared to populations with narrow, uniform beak sizes.$

Answer: Graph (2): the graph showing the broadest range/greatest variation in beak depth

Populations with greater phenotypic variation are more likely to contain individuals with traits (here, beak depth) suited to new environmental conditions, increasing the population's overall chance of survival.

Question 76 · 2 pts

The chart below compares some of the characteristics of four different plant species. Comparison of Four Plant Species | Plant Species | Flower Color | Enzyme X Present | Leaf Shape/Color | Number of Flower Petals | |---|---|---|---|---| | A | blue | yes | oval/dark green | 7 | | B | blue | no | oval/yellow green | 5 | | C | red | yes | oval/dark green | 7 | | D | red | no | oval/dark green | 5 | According to the information provided in the chart, which two plant species appear to be the most closely related?

(A) A and B
(B) B and D
(C) C and A ✓
(D) D and C

Worked solution

$Compare shared traits: Species A (blue, enzyme X yes, oval/dark green, 7 petals) and Species C (red, enzyme X yes, oval/dark green, 7 petals) share 3 of 4 traits (enzyme X, leaf shape/color, petal number), differing only in flower color.$

$Other pairings (A and B, B and D, D and C) share fewer matching traits.$

$Species that share the most traits are considered most closely related.$

Answer: C and A

Species A and C share enzyme presence, leaf shape/color, and petal number, differing only in flower color, making them the most similar and therefore most likely closely related pair.

Question 77 · 1 pt · constructed response

Base your answers to questions 77 and 78 on the information below and on your knowledge of biology. A gene segment from a species of plant has the following sequence: ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC 77 This segment was cut with a restriction enzyme that recognizes CCGG and cuts between the C and G. The fragments were then analyzed using gel electrophoresis. How many bands would you expect to appear on the gel?

Model answer: 4 bands

Worked solution

$Search the sequence ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC for the recognition site CCGG.$

$CCGG occurs at three locations: positions 4-7, positions 16-19, and positions 27-30.$

$The enzyme cuts between the C and G in each CCGG, at 3 sites, which cuts the 37-base sequence into 4 fragments (lengths 5, 12, 11, and 9 bases).$

$Since all 4 fragments are different lengths, gel electrophoresis would separate them into 4 distinct bands.$

Answer: 4 bands

Locating all three CCGG recognition sites shows the enzyme makes 3 cuts, producing 4 fragments of different sizes, which appear as 4 separate bands on the gel.

Question 78 · 1 pt · constructed response

Once the gel is running, explain why the segments would move different distances in the gel.

Model answer: DNA fragments are negatively charged and move through the gel toward the positive electrode under the electric current. Smaller (shorter) fragments move through the gel matrix more easily and travel farther, while larger (longer) fragments move more slowly and travel a shorter distance, so fragments of different sizes end up at different distances from the starting point.

Worked solution

$An electric current is applied to the gel, pulling the negatively charged DNA fragments toward the positive end.$

$Smaller fragments experience less resistance moving through the gel's pores and travel farther in a given time.$

$Larger fragments experience more resistance and travel a shorter distance, resulting in fragments separating by size.$

Answer: DNA fragments are negatively charged and move through the gel toward the positive electrode under the electric current. Smaller (shorter) fragments move through the gel matrix more easily and travel farther, while larger (longer) fragments move more slowly and travel a shorter distance, so fragments of different sizes end up at different distances from the starting point.

Gel electrophoresis separates DNA fragments by size because smaller fragments migrate faster/farther through the gel matrix than larger fragments under the same electric field.

Question 79 · 1 pt · constructed response

Students in a class performed an experiment. They recorded their resting pulse rates. Then, they ran in place and immediately recorded their pulse rates again. The data obtained are shown in the two histograms below. Class Data - Resting Pulse Rates (Number of Students by Average Pulse Rate Range, per min): <50: 2, 51-60: 5, 61-70: 7, 71-80: 11, 81-90: 3, >90: 0 Class Data - Pulse Rates After Activity (Number of Students by Average Pulse Rate Range, per min): <50: 0, 51-60: 2, 61-70: 3, 71-80: 5, 81-90: 7, >90: 11 79 State one hypothesis about the effects of exercise on pulse rate.

Model answer: Physical exercise/activity increases a person's pulse rate. (For example: If a person runs in place, then their pulse rate will increase compared to their resting pulse rate.)

Worked solution

$Compare the two histograms: resting pulse rates are concentrated in the lower ranges (mostly 71-80 and below), while after-activity pulse rates are concentrated in the higher ranges (mostly 81-90 and >90).$

$This shift toward higher pulse rates after running in place suggests exercise raises pulse rate.$

$State this relationship as a testable hypothesis, e.g., 'If a student exercises, then their pulse rate will increase.'$

Answer: Physical exercise/activity increases a person's pulse rate. (For example: If a person runs in place, then their pulse rate will increase compared to their resting pulse rate.)

A hypothesis should be a testable statement predicting a relationship between exercise and pulse rate, supported by the shift in the data from lower to higher pulse rate ranges after activity.

Question 80 · 1 pt · constructed response

A student in a biology class squeezed a clothespin as many times as possible in a 60-second period. After resting for 20 seconds, they then repeated the experiment, for a total of five trial periods of 'squeezing/resting.' The student recorded their experimental data in the table below. Clothespin Data | Trial | Number of Clothespin Squeezes in 60 Seconds | |---|---| | 1 | 82 | | 2 | 75 | | 3 | 58 | | 4 | 50 | | 5 | 45 | The student reported feeling some burning in their finger muscles after squeezing the clothespin. The teacher explained that the burning sensation may have been due to a buildup of waste products in the finger muscles. 80 Predict the number of clothespin squeezes expected if the student had performed a sixth trial. Support your answer.

Model answer: Fewer than 45 squeezes (for example, about 40), because the number of squeezes has been decreasing with each trial as waste products (such as lactic acid) continue to build up in the finger muscles, causing increasing fatigue.

Worked solution

$Observe the data trend: the number of squeezes decreases each trial (82, 75, 58, 50, 45).$

$This decreasing trend is caused by a continuing buildup of waste products in the muscle, leading to increasing fatigue with each successive trial.$

$Since the trend of decreasing squeezes and increasing fatigue would likely continue, a sixth trial should show a number lower than 45.$

Answer: Fewer than 45 squeezes (for example, about 40), because the number of squeezes has been decreasing with each trial as waste products (such as lactic acid) continue to build up in the finger muscles, causing increasing fatigue.

Because muscle fatigue increases as waste products accumulate with repeated exertion, the decreasing trend seen across trials 1-5 would be expected to continue into a sixth trial, yielding a number of squeezes below 45.

Question 81 · 2 pts

A recent newspaper headline read, 'Expert Warns About Effect of Rock Salt on Plants.' The de-icing chemical, rock salt, has been used on highways for years. The concern expressed by the expert is most likely that

(A) the salt will enter the plants and make them too salty and unusable as food
(B) the presence of salt in the environment will cause the plants to lose water ✓
(C) de-icing chemicals always present a safety risk to humans
(D) plants respond more rapidly to salt in colder temperatures

Worked solution

$High salt concentration in soil lowers the water potential outside plant root cells.$

$By osmosis, water moves from an area of higher water concentration (inside root cells) to lower water concentration (salty soil), causing water to leave the plant's cells.$

$This water loss can dehydrate and damage or kill the plant, which is the expert's likely environmental concern.$

Answer: the presence of salt in the environment will cause the plants to lose water

Excess salt in soil disrupts the normal osmotic balance, drawing water out of plant cells and causing dehydration, which is the key homeostatic concern with road salt runoff.

Question 82 · 2 pts

Some runners prepare for a race by completing a variety of warmups. These exercises are beneficial because they

(A) can prevent the production of carbon dioxide in muscle cells
(B) speed up the breakdown of protein that is released during respiration
(C) reduce the need for water in muscle cell metabolism
(D) can increase the flow of blood within the body ✓

Worked solution

$Warming up raises heart rate and dilates blood vessels in the muscles.$

$This increases blood flow, delivering more oxygen and glucose to muscle cells and removing waste products more efficiently.$

$Improved circulation helps muscles perform better and reduces injury risk during the race.$

Answer: can increase the flow of blood within the body

Warmups increase circulation, improving oxygen and nutrient delivery to muscles and waste removal, which is why increased blood flow is the correct benefit described.

Question 83 · 1 pt · constructed response

A group of students took their pulse rates. The results are shown in the graph below. Students' Pulse Rates (Number of Students by Pulse in beats/minute): <50: 1, 51-60: 0, 61-70: 2, 71-80: 4, 81-90: 0, >90: 1 A student wrote the hypothesis, 'Students who smoke tend to have a higher pulse rate than students who do not smoke.' 83 What additional information is needed to test the student's hypothesis?

Model answer: The smoking status of each student (which students smoke and which do not) would need to be known, so that the pulse rates of the smoking group and the non-smoking group could be compared directly.

Worked solution

$The current graph only shows overall pulse rate distribution for the group, without identifying which students smoke.$

$To test the hypothesis, students would need to be separated into two groups: smokers and non-smokers.$

$Comparing average/typical pulse rates between these two identified groups would allow the hypothesis to be properly tested.$

Answer: The smoking status of each student (which students smoke and which do not) would need to be known, so that the pulse rates of the smoking group and the non-smoking group could be compared directly.

Testing a hypothesis comparing smokers and non-smokers requires knowing each subject's smoking status so pulse rate data can be grouped and compared between the two categories.

Question 84 · 1 pt · constructed response

Base your answers to questions 84 and 85 on the diagram below and on your knowledge of biology. The diagram illustrates different finch species living in a certain area. Warbler finch: probing bill, insect eater, feeds in trees Woodpecker finch: probing bill, insect eater, uses twig or cactus spine to remove insects from cactus Mangrove finch: grasping bill, insect eater, feeds in trees Vegetarian finch: crushing bill, cactus-seed eater 84 If the common ancestor of the four finches originally lived on an island with few trees, little rain, and very few insects, identify which finch it might most likely resemble and support your answer.

Model answer: The vegetarian finch, because with few trees, little rain, and very few insects available, a finch depending on trees or insects for food (like the warbler, woodpecker, or mangrove finch) would not have enough resources to survive. A crushing bill adapted to eating cactus seeds would allow the ancestor to survive in a dry environment where cactus (which needs little rain) may be one of the only reliable food sources.

Worked solution

$Consider the environment described: few trees, little rain, very few insects.$

$Eliminate finches that depend heavily on trees and/or insects for food: warbler finch (trees, insects), woodpecker finch (insects), mangrove finch (trees, insects).$

$The vegetarian finch's cactus-seed diet does not require trees, rain, or insects, since cacti are drought-tolerant plants, making this the best match for the described environment.$

Answer: The vegetarian finch, because with few trees, little rain, and very few insects available, a finch depending on trees or insects for food (like the warbler, woodpecker, or mangrove finch) would not have enough resources to survive. A crushing bill adapted to eating cactus seeds would allow the ancestor to survive in a dry environment where cactus (which needs little rain) may be one of the only reliable food sources.

An ancestor in an environment lacking trees, rain, and insects would need a food source independent of those resources; cactus seeds (eaten by the vegetarian finch) fit a dry, cactus-dominated habitat.

Question 85 · 1 pt · constructed response

Identify the finch in the diagram most likely to compete with the mangrove finch. Support your answer.

Model answer: The warbler finch, because both the warbler finch and the mangrove finch are insect eaters that feed in trees, meaning they rely on the same food source and habitat, putting them in competition with each other.

Worked solution

$Compare the mangrove finch's traits (grasping bill, insect eater, feeds in trees) to the other finches.$

$The warbler finch shares the same diet (insect eater) and same feeding location (feeds in trees) as the mangrove finch.$

$Species that share the same food source and habitat/niche are most likely to compete with one another.$

Answer: The warbler finch, because both the warbler finch and the mangrove finch are insect eaters that feed in trees, meaning they rely on the same food source and habitat, putting them in competition with each other.

Organisms occupying the same niche, here insect-eating birds that forage in trees, compete for the same limited resources, making the warbler finch the closest competitor to the mangrove finch.

June 2025 Living Environment Regents — Answer Key & Worked Solutions

More Living Environment Regents help